View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9869_low_46 (Length: 250)

Name: NF9869_low_46
Description: NF9869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9869_low_46
NF9869_low_46
[»] chr2 (1 HSPs)
chr2 (20-230)||(7682940-7683149)


Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 20 - 230
Target Start/End: Complemental strand, 7683149 - 7682940
Alignment:
20 aggcatactttcactaatttatggtgtcgaggaatggtaggaaggttggggttggcggaagttttaagggtcgaggttcgcttcgaagtgatggaaggag 119  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
7683149 aggcatactttcacgaatttatggtgtcgaggaatggtaggaaggttggggttggcggaagttttaagg-tcgaggttcgcttcgaagtgatggaaggag 7683051  T
120 ttgatgaatttagaggaggatgtgggttggaattggttcaaaaatagggtggtgagaaaggttgataatagtcattttacgagtttttggagggacaaat 219  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7683050 ttgatgaatgtagaggaggatgtgggttggaattggttcaaaaatagggtggtgagaaaggttgataatagtcattttacgagtttttggagggacaaat 7682951  T
220 gggttggaaat 230  Q
    |||||||||||    
7682950 gggttggaaat 7682940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University