View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9869_low_49 (Length: 246)
Name: NF9869_low_49
Description: NF9869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9869_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 19 - 227
Target Start/End: Complemental strand, 49607451 - 49607243
Alignment:
| Q |
19 |
ggttcaatatattatataatttcccgtttgaaggtggtgctcttgnnnnnnnnnnggactcatcaaaccatttgcattagtgcatcaaatgcttaggtta |
118 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49607451 |
ggtttaatatattatataatttcccgtttgaaagtggtgctcttgaaaaaaaaatggacccatcaaaccatttgcattagtgcatcaaatgcttaggtta |
49607352 |
T |
|
| Q |
119 |
ttttgataaagaaaaacctattcctaccaccttcatggatgaagaatcataaaatcaactcaaatttaaaaaatgaagaatcagaggaagatacatgata |
218 |
Q |
| |
|
|| ||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
49607351 |
ttgtgataaaaaaaaacctattgctaccaccttcatggatgaagaatcataaaatcaactcaaatttaaaaaatgaagaatcataggaagatacatgata |
49607252 |
T |
|
| Q |
219 |
aagtagtca |
227 |
Q |
| |
|
||||||||| |
|
|
| T |
49607251 |
aagtagtca |
49607243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University