View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9869_low_53 (Length: 239)
Name: NF9869_low_53
Description: NF9869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9869_low_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 19281450 - 19281227
Alignment:
| Q |
1 |
tatatttgtatgcaaacacgaaattgatcatgatttccaatccattttcaaacatggtttcttggaccaaaaaggggatggacaagtcatgtattattc- |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
19281450 |
tatatttgtatgcaaacacgaaattgatcatgatttccaatccattttcaaacatggtttcttggaccaaaaaggggatggacaagtcatgtataatgag |
19281351 |
T |
|
| Q |
100 |
--cacatataattttgacataaacacatgaagagagattctct--agtctctacaatagtcaaattgaaaatgtattactttatatgacatgtatatact |
195 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19281350 |
ctcatatataattttgacataaacacatgaagagagattctctctagtctctacaatagtcaaattgaaaatgtattactttatatgacatgcatatact |
19281251 |
T |
|
| Q |
196 |
actagtttttatggttggtctaat |
219 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
19281250 |
actagtttttatggttggtctaat |
19281227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University