View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9869_low_55 (Length: 233)
Name: NF9869_low_55
Description: NF9869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9869_low_55 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 130 - 216
Target Start/End: Complemental strand, 25934634 - 25934548
Alignment:
| Q |
130 |
ttttgggaattggttagggttttgaggatttgggagagggtggtgttaggggtggaggggtttatgagaagggaacgaattgaagat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25934634 |
ttttgggaattggttagggttttgaggatttgggagagggtggtgttaggggtggaggggtttatgagaagggaacgaattgaagat |
25934548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 14 - 62
Target Start/End: Complemental strand, 25934750 - 25934702
Alignment:
| Q |
14 |
caaagggtttggatgaaggaagttgtgaaatggaggcgagggaatcgac |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25934750 |
caaagggtttggatgaaggaagttgtgaaatggaggcgagggaatcgac |
25934702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University