View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9869_low_56 (Length: 230)
Name: NF9869_low_56
Description: NF9869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9869_low_56 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 11438845 - 11438695
Alignment:
| Q |
10 |
aggagcagagaaatgttgtaacttcttcttcttgtttcagcatgttgttgatctcttgaggatgttgttcgatctggttcctggttttgggtcggtgggt |
109 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |
|
|
| T |
11438845 |
aggagcagagaagtgttgtaacttcttcttcttgtttcaacatgttgttgatctcttgaggatgttgttcgatctagttcctggttttgggtcggtggat |
11438746 |
T |
 |
| Q |
110 |
cgtgtggatcccttggctgattgggttaaggattcgtagcatgtctgccga |
160 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11438745 |
cgtgtggatcccttggctggttgggttaaggattcgtagcatgtctgccga |
11438695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University