View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9869_low_57 (Length: 230)
Name: NF9869_low_57
Description: NF9869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9869_low_57 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 127 - 224
Target Start/End: Original strand, 1181313 - 1181410
Alignment:
| Q |
127 |
aattaagtacttgattcattattggttaattcaatttgtatgtttagttattaatttttgtgtatacttgccccgtcatatatatgtaggatgcattg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1181313 |
aattaagtacttgattcattattggttaattcgatttgtatgtttagttattaatttttgtgtatacttgccccgtcatatatatgtaggatgcattg |
1181410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 27 - 100
Target Start/End: Complemental strand, 41863964 - 41863891
Alignment:
| Q |
27 |
ggttgcaattgttagtttgatgtttggcaacatgccctggttgataaatcacctccgtttggctatagcattgg |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| ||||| |
|
|
| T |
41863964 |
ggttgcatgtgttagtttgatgtttggcaacatgccctggctgataaatcacctctgtttggctatagtattgg |
41863891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University