View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9869_low_57 (Length: 230)

Name: NF9869_low_57
Description: NF9869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9869_low_57
NF9869_low_57
[»] chr6 (1 HSPs)
chr6 (127-224)||(1181313-1181410)
[»] chr8 (1 HSPs)
chr8 (27-100)||(41863891-41863964)


Alignment Details
Target: chr6 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 127 - 224
Target Start/End: Original strand, 1181313 - 1181410
Alignment:
127 aattaagtacttgattcattattggttaattcaatttgtatgtttagttattaatttttgtgtatacttgccccgtcatatatatgtaggatgcattg 224  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1181313 aattaagtacttgattcattattggttaattcgatttgtatgtttagttattaatttttgtgtatacttgccccgtcatatatatgtaggatgcattg 1181410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 27 - 100
Target Start/End: Complemental strand, 41863964 - 41863891
Alignment:
27 ggttgcaattgttagtttgatgtttggcaacatgccctggttgataaatcacctccgtttggctatagcattgg 100  Q
    |||||||  ||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |||||    
41863964 ggttgcatgtgttagtttgatgtttggcaacatgccctggctgataaatcacctctgtttggctatagtattgg 41863891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University