View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9869_low_63 (Length: 219)
Name: NF9869_low_63
Description: NF9869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9869_low_63 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 2 - 206
Target Start/End: Original strand, 44576413 - 44576617
Alignment:
| Q |
2 |
atggtatgagtttttgagaactcttgtccttgtatttgtttttgacagtttatgtgcctggaacatgatagtgtagtccctttgcaattgtaatgttggg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44576413 |
atggtatgagtttttgagaactcttgtccttgtatttgtttttgacagtttatgtgcctggaacatgatagtgtagtccctttgcaattgtaatgttggg |
44576512 |
T |
|
| Q |
102 |
atattttgtgaatgtctagtactagagaaaggggatacatgaatgaggccttctatggatcaacgagtcgaaattttagaacaaaggttgcaaactgccc |
201 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44576513 |
atattttgtgaatgtcttgtactagagaaaggggatacatgaatgaggccttctatggatcaacgagtcgaaattttagaataaaggttgcaaactgccc |
44576612 |
T |
|
| Q |
202 |
tttgc |
206 |
Q |
| |
|
||||| |
|
|
| T |
44576613 |
tttgc |
44576617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 11 - 161
Target Start/End: Original strand, 1508687 - 1508836
Alignment:
| Q |
11 |
gtttttgagaactcttgtccttgtatttgtttttgacagtttatgtgcctggaacatgatagtgtagtccctttgcaattgtaatgttgggatattttgt |
110 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||| |||||||| ||| || | ||||||||| ||||||||||||||||||| |||| |||| |||| | |
|
|
| T |
1508687 |
gtttttgagaactcttgttcttgtatttggttt-gacagtttgggtgtctagcacatgatagagtagtccctttgcaattgtgttgttaggatttttttt |
1508785 |
T |
|
| Q |
111 |
gaatgtctagtactagagaaaggggatacatgaatgaggccttctatggat |
161 |
Q |
| |
|
|| | ||| ||| ||||||| |||||||||||| |||| || ||||||| |
|
|
| T |
1508786 |
gagtatcttgtattagagaagagggatacatgaacaaggcattttatggat |
1508836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 11 - 103
Target Start/End: Original strand, 12122432 - 12122523
Alignment:
| Q |
11 |
gtttttgagaactcttgtccttgtatttgtttttgacagtttatgtgcctggaacatgatagtgtagtccctttgcaattgtaatgttgggat |
103 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||| ||| || | ||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
12122432 |
gtttttgagaactcttgtccttgtaattgtttt-gacagtttgggtgtctagctcatgataatgtagtccctttgcaattgtactgttgggat |
12122523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University