View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9869_low_68 (Length: 211)
Name: NF9869_low_68
Description: NF9869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9869_low_68 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 195
Target Start/End: Original strand, 53884564 - 53884742
Alignment:
| Q |
17 |
aaaggcggcgaaactgatgaagaggaagaagagggatgtgagaagaagcatgatgatgggtttgaggaatagggagaggagattagggtttgattttggt |
116 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
53884564 |
aaaggcggcgaaaccgaggaagaggaagaagagggatgtgagaagaagcatgatgatgggtttgaggaatagggagaggagattagggtttggttttggt |
53884663 |
T |
|
| Q |
117 |
tgttcaggatcgccatggtgatgatgaggaggcatggtcgtggttgaaattgaaggtttgaaaaaatggtggcaataat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53884664 |
tgttcaggatcgccatggtgatgatgaggaggcatggtcgtggttgaaattgaaggtttgaaaaaatggtggcaataat |
53884742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 195
Target Start/End: Original strand, 53890678 - 53890856
Alignment:
| Q |
17 |
aaaggcggcgaaactgatgaagaggaagaagagggatgtgagaagaagcatgatgatgggtttgaggaatagggagaggagattagggtttgattttggt |
116 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
53890678 |
aaaggcggcgaaaccgaggaagaggaagaagagggatgtgagaagaagcatgatgatgggtttgaggaatagggagaggagattagggtttggttttggt |
53890777 |
T |
|
| Q |
117 |
tgttcaggatcgccatggtgatgatgaggaggcatggtcgtggttgaaattgaaggtttgaaaaaatggtggcaataat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53890778 |
tgttcaggatcgccatggtgatgatgaggaggcatggtcgtggttgaaattgaaggtttgaaaaaatggtggcaataat |
53890856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University