View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9869_low_69 (Length: 211)
Name: NF9869_low_69
Description: NF9869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9869_low_69 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 95 - 197
Target Start/End: Complemental strand, 21552033 - 21551932
Alignment:
| Q |
95 |
caaagtaggttttgacgactctctccgatcttaaatctaagtaaaaaataaaggtgacgattgagtccatttatcccttatttattgtactataaattca |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
21552033 |
caaagtaggttttgacgactctctccgatcttaaatctaag-aaaaaatgaaggtgacgattgagtccatgtatcccttatctattgtactataaattca |
21551935 |
T |
|
| Q |
195 |
tct |
197 |
Q |
| |
|
||| |
|
|
| T |
21551934 |
tct |
21551932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 48
Target Start/End: Complemental strand, 21552112 - 21552080
Alignment:
| Q |
16 |
gtttcttcatccctcctccccttatatactatc |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
21552112 |
gtttcttcatccctcctccccttatatactatc |
21552080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University