View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9871_high_6 (Length: 346)

Name: NF9871_high_6
Description: NF9871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9871_high_6
NF9871_high_6
[»] chr3 (3 HSPs)
chr3 (42-334)||(1726542-1726834)
chr3 (146-225)||(13361622-13361701)
chr3 (146-225)||(13293506-13293585)
[»] chr7 (2 HSPs)
chr7 (94-222)||(4447384-4447512)
chr7 (107-320)||(10347322-10347535)
[»] chr4 (2 HSPs)
chr4 (152-225)||(11450232-11450305)
chr4 (146-194)||(12407100-12407148)
[»] chr8 (1 HSPs)
chr8 (101-238)||(17932256-17932393)
[»] chr6 (2 HSPs)
chr6 (22-238)||(17235652-17235869)
chr6 (132-189)||(25723558-25723615)
[»] chr2 (1 HSPs)
chr2 (152-194)||(22677941-22677983)
[»] chr1 (1 HSPs)
chr1 (144-194)||(23976337-23976387)
[»] scaffold0011 (1 HSPs)
scaffold0011 (132-185)||(67272-67325)


Alignment Details
Target: chr3 (Bit Score: 257; Significance: 1e-143; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 42 - 334
Target Start/End: Original strand, 1726542 - 1726834
Alignment:
42 atttctgaccaaaatatttaagtaccttaccaagaagaaaaatgtttccaactagaactagtggatctaaaggatcaggctacaaggatgagaaggatga 141  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
1726542 atttctgaccaaaatattcaagtaccttaccaagaagaaaaatgtttccaactagaactagtggatctaaaggatcagactacaaggatgagaaggatga 1726641  T
142 ttagaagggttgcttcaacagcaagaaacatgatcacttcattgctgattgtctagagttgcagacggacaagtcaaagaaggaaatctctaagaagtaa 241  Q
    ||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||    
1726642 ttagaagggtttcttcaacagcaagaaacctggtcacttcattgctgattgtctagagttgcagacgaacaagtcaaagaaggaaatctctaagaaataa 1726741  T
242 agattcaaaattagagtcaagaaaggtttcatgtcaacatgggatgaacttgatgaagaaactaatgaagaagaagccattatgactttgatg 334  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
1726742 agattcaaaattagattcaagaaaggtttcatgtcaacatgggatgaacttgatgaagaaactaatgaagaagaagccaatatgactttgatg 1726834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 146 - 225
Target Start/End: Complemental strand, 13361701 - 13361622
Alignment:
146 aagggttgcttcaacagcaagaaacatgatcacttcattgctgattgtctagagttgcagacggacaagtcaaagaagga 225  Q
    ||||||||||||  | ||||||||| || ||| ||||||||||||||||||||||| ||||  |||||||||||||||||    
13361701 aagggttgcttccgctgcaagaaacttggtcatttcattgctgattgtctagagttacagaaagacaagtcaaagaagga 13361622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 146 - 225
Target Start/End: Original strand, 13293506 - 13293585
Alignment:
146 aagggttgcttcaacagcaagaaacatgatcacttcattgctgattgtctagagttgcagacggacaagtcaaagaagga 225  Q
    ||||||||||||  | ||||||||| || ||| ||||||||||| ||||||||||| ||||  ||||||| |||||||||    
13293506 aagggttgcttccgctgcaagaaacttggtcatttcattgctgactgtctagagttacagaaagacaagtgaaagaagga 13293585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 57; Significance: 9e-24; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 94 - 222
Target Start/End: Complemental strand, 4447512 - 4447384
Alignment:
94 tagaactagtggatctaaaggatcaggctacaaggatgagaaggatgattagaagggttgcttcaacagcaagaaacatgatcacttcattgctgattgt 193  Q
    ||||| |||| |||| |||||||| || ||||| |   |||| ||| || ||||||| ||||||||| ||||||||| ||||||||||||| |||| |||    
4447512 tagaagtagtagatcaaaaggatctggatacaaaggctagaaagataatcagaagggatgcttcaactgcaagaaacctgatcacttcattactgactgt 4447413  T
194 ctagagttgcagacggacaagtcaaagaa 222  Q
    ||||||||||||| |||||||||||||||    
4447412 ctagagttgcagaaggacaagtcaaagaa 4447384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 107 - 320
Target Start/End: Original strand, 10347322 - 10347535
Alignment:
107 tctaaaggatcaggctacaaggatgagaaggatgattagaagggttgcttcaacagcaagaaacatgatcacttcattgctgattgtctagagttgcaga 206  Q
    |||||||||||||| ||||| ||| ||||||||||    || |||||||||||  |||| |||| ||  ||||||||| |||| |||| |||||| | ||    
10347322 tctaaaggatcaggatacaaagataagaaggatgaccgaaaaggttgcttcaattgcaaaaaacttgtccacttcatttctgactgtccagagttactga 10347421  T
207 cggacaagtcaaagaaggaaatctctaagaagtaaagattcaaaattagagtcaagaaaggtttcatgtcaacatgggatgaacttgatgaagaaactaa 306  Q
     | |||||| |||||| |||| |||||||||| | |  |||||||  | |||||| ||| ||  |||| |||||||||| || ||| ||||| ||||| |    
10347422 agaacaagttaaagaatgaaagctctaagaaggagaatttcaaaagcaaagtcaataaaagtcacatggcaacatgggaagatcttcatgaataaactga 10347521  T
307 tgaagaagaagcca 320  Q
    ||||||||||||||    
10347522 tgaagaagaagcca 10347535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 152 - 225
Target Start/End: Original strand, 11450232 - 11450305
Alignment:
152 tgcttcaacagcaagaaacatgatcacttcattgctgattgtctagagttgcagacggacaagtcaaagaagga 225  Q
    ||||||||||||||||||| |||||| ||||||| |||||||| |||||| |||| ||||||||| ||||||||    
11450232 tgcttcaacagcaagaaacttgatcatttcattgttgattgtccagagttacagaaggacaagtcgaagaagga 11450305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 146 - 194
Target Start/End: Original strand, 12407100 - 12407148
Alignment:
146 aagggttgcttcaacagcaagaaacatgatcacttcattgctgattgtc 194  Q
    ||||| ||||||||| | ||||||| || ||||||||||||||||||||    
12407100 aagggatgcttcaactgtaagaaacctggtcacttcattgctgattgtc 12407148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 101 - 238
Target Start/End: Original strand, 17932256 - 17932393
Alignment:
101 agtggatctaaaggatcaggctacaaggatgagaaggatgattagaagggttgcttcaacagcaagaaacatgatcacttcattgctgattgtctagagt 200  Q
    ||||| || ||| ||||| ||||||||||| ||||||||||| |||||||||||||| || ||||||| | || |||| | ||| ||  ||||| ||| |    
17932256 agtgggtccaaatgatcaagctacaaggataagaaggatgatcagaagggttgcttccactgcaagaagcctggtcacgtgattacttgttgtccagatt 17932355  T
201 tgcagacggacaagtcaaagaaggaaatctctaagaag 238  Q
    |||| | ||||||||  ||||| |||| ||||||||||    
17932356 tgcaaaaggacaagtgtaagaaagaaagctctaagaag 17932393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 238
Target Start/End: Complemental strand, 17235869 - 17235652
Alignment:
22 ttagatgctgaagagatgacatttctgaccaaaatatttaagtaccttacc--aagaagaaaaatgtttccaactagaactagtggatctaaaggatcag 119  Q
    ||||||||| |||||||||||||||||||||||| || | ||||||| |||  |||||| |||||||||  |  ||||| | ||  ||  ||||||||      
17235869 ttagatgctaaagagatgacatttctgaccaaaagatatcagtacctgaccaaaagaag-aaaatgtttttaggtagaagttgtatataaaaaggatcga 17235771  T
120 gctacaaggatgagaaggatgattagaagggttgcttcaacagcaagaaacatgatcacttcattgctgattgtctagagttgcagacggacaagtcaaa 219  Q
    | |||||| || |||| |||||| ||||||  | ||||||  ||||||||| || |||||| || |  || |  ||||||||||||| |||| || ||||    
17235770 gttacaagtataagaaagatgatcagaaggaatacttcaattgcaagaaacctggtcactttatagacgacttcctagagttgcagaaggacgagccaaa 17235671  T
220 gaaggaaatctctaagaag 238  Q
    ||| |||||||||||||||    
17235670 gaaagaaatctctaagaag 17235652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 132 - 189
Target Start/End: Original strand, 25723558 - 25723615
Alignment:
132 agaaggatgattagaagggttgcttcaacagcaagaaacatgatcacttcattgctga 189  Q
    ||||||| ||| ||||||| ||||||||| ||||||||| || ||| |||||||||||    
25723558 agaaggaagatcagaaggggtgcttcaactgcaagaaacctggtcatttcattgctga 25723615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 152 - 194
Target Start/End: Complemental strand, 22677983 - 22677941
Alignment:
152 tgcttcaacagcaagaaacatgatcacttcattgctgattgtc 194  Q
    ||||||||| ||||||||| || ||||||||||||||||||||    
22677983 tgcttcaactgcaagaaacttggtcacttcattgctgattgtc 22677941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 144 - 194
Target Start/End: Original strand, 23976337 - 23976387
Alignment:
144 agaagggttgcttcaacagcaagaaacatgatcacttcattgctgattgtc 194  Q
    ||||||| ||||||||| ||||||||  || ||||||||||||||||||||    
23976337 agaagggatgcttcaactgcaagaaatctggtcacttcattgctgattgtc 23976387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 132 - 185
Target Start/End: Original strand, 67272 - 67325
Alignment:
132 agaaggatgattagaagggttgcttcaacagcaagaaacatgatcacttcattg 185  Q
    ||||||| ||| ||||||| ||||||||| ||||||| |||| |||||||||||    
67272 agaaggaagatcagaagggatgcttcaactgcaagaagcatgttcacttcattg 67325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University