View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9871_low_11 (Length: 238)
Name: NF9871_low_11
Description: NF9871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9871_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 4191470 - 4191265
Alignment:
| Q |
1 |
gtattcatgtaataactttcctttcccaacaaataagcggtataggttttagtatatagttagaaatcagaggactgaggagatacatttaacttcgctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
4191470 |
gtattcatgtaataactttcctttcccaacaaataagtggtataggttttagtatatagttagaaatcagaggactgaggagatccatttaac-tcgctt |
4191372 |
T |
|
| Q |
101 |
attctttctacgataagctattttttaagggtaatcttgtaatggtcac-tttttcttgcttcaagcttctatcctttgacaccgactcccttcacttgc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4191371 |
attctttctacgataagctattttttaagggtaatcttgtaatggtcacttttttcttgcttcaagcttctatcctttgacaccgactcccttcacttgc |
4191272 |
T |
|
| Q |
200 |
gagtcaa |
206 |
Q |
| |
|
||||||| |
|
|
| T |
4191271 |
gagtcaa |
4191265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University