View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9871_low_13 (Length: 209)
Name: NF9871_low_13
Description: NF9871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9871_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 15 - 198
Target Start/End: Complemental strand, 3272532 - 3272349
Alignment:
| Q |
15 |
agatatcatcttcgaggatataatactatatcaaacaaattaccctgtatatatcgaccaacattatatgaagaccccagaacaggttaacaaaaaataa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3272532 |
agatatcatcttcgaggatataatactatatcaaacaaattaccctgtatatatcgaccaacattatatgaagaccccagaacaggttaacaaaaaataa |
3272433 |
T |
|
| Q |
115 |
ttaatttttctctcacgtagtgtttattaatttttgttttcatttttgttgcagcaccaagcagtgaaaataagtaacaccaaa |
198 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3272432 |
ttaatttttctctcacgtagtgttgattaatttttgttttcatttttgttgcagcaccaagcagtgaaaataagtaacatcaaa |
3272349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 17 - 103
Target Start/End: Complemental strand, 3278270 - 3278184
Alignment:
| Q |
17 |
atatcatcttcgaggatataatactatatcaaacaaattaccctgtatatatcgaccaacattatatgaagaccccagaacaggtta |
103 |
Q |
| |
|
|||||||||| ||||||||||| || ||||||||||||| ||||||| ||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
3278270 |
atatcatctttgaggatataatcataaatcaaacaaattatcctgtatttattgaccaacattatatgagaaccccagaacaggtta |
3278184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 156 - 193
Target Start/End: Complemental strand, 3278119 - 3278082
Alignment:
| Q |
156 |
atttttgttgcagcaccaagcagtgaaaataagtaaca |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3278119 |
atttttgttgcagcaccaagcagtgaaaataagtaaca |
3278082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University