View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9871_low_8 (Length: 315)
Name: NF9871_low_8
Description: NF9871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9871_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 306
Target Start/End: Complemental strand, 35697326 - 35697021
Alignment:
| Q |
1 |
tgctgttccaaagcacgaaaacaacccgctcccttgccttcggtgcttccctttcccttcccctttcgtttgtttcccagttttcttcaccctatcatta |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||| | ||| ||||| |||| |||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
35697326 |
tgctgttccaaagcacgaaaacaaaccgctaccttgccttcgattcttacctttacctttccctttcgtttgtttcccagttttcttcacactaccatta |
35697227 |
T |
|
| Q |
101 |
ttattatcccccaaatgaccataaacctgcggtatatctatctgcctcccccggcccatcttcgtgttcaacatctccccgccattgtccttctccggcg |
200 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||| |||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35697226 |
ttattattccccaaatgatcataaacctgcggtatatctatctgtctccaccggtccatcttcgtgttcaacatctccccgccattgtccttctccggcg |
35697127 |
T |
|
| Q |
201 |
gccatttctcaaacattgaattattcaccgtctttcttggcacgtgcaatggcaacggatacaatcctttcgctatcgcggcagccaccacagacggtga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35697126 |
gccatttctcaaacattgaattattcaccgtctttcttggcacgtgcaatggcaacggatacaatcctttcgctatcgcggcagccaccacagacggtga |
35697027 |
T |
|
| Q |
301 |
aggtcc |
306 |
Q |
| |
|
|||||| |
|
|
| T |
35697026 |
aggtcc |
35697021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University