View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9872_low_10 (Length: 319)
Name: NF9872_low_10
Description: NF9872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9872_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 9 - 306
Target Start/End: Complemental strand, 31943218 - 31942920
Alignment:
| Q |
9 |
agcacagactccatggatgatggcagaggtccacccaaaaggattagaggaaatcaccaatctcctaatacattggcaagttcttctaatgggattgcta |
108 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
31943218 |
agcatagactccatggattctggtagaggtccacccaaaaggattagaggaaatcaccaatctcctagtacattggcaagttcttttaatgggattgcta |
31943119 |
T |
 |
| Q |
109 |
tgagggataatgcaacattgttatctcaaattcatttgctggatcaagtaggacaacttggtaattcatggagcaggttcagtcaatcaattatggtgaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||| | ||||||||||||||||||| |
|
|
| T |
31943118 |
tgagggataatgcaacattgttatctcaaattcacttgctcgatcaagtaggacaacttggtaattcatggagaaggcccggtcaatcaattatggtgaa |
31943019 |
T |
 |
| Q |
209 |
taacggtaataaccatttagttcctgaaaataatttggtgcaacacttttggccaacgcctcatatacaaggtaaagtttaatttt-ttattttgatgt |
306 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
31943018 |
taacggtaatagccatttagttcctgaaaacaatttggtgcaacacttttggccaacgcctcatatacaaggtaaaattttattttcttattttgatgt |
31942920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 16 - 283
Target Start/End: Complemental strand, 31952404 - 31952125
Alignment:
| Q |
16 |
actccatggatgatggcagaggtccacccaaaaggattagaggaaatcaccaatctcctaatacattggcaagttctt------------ctaatgggat |
103 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| | | | |
|
|
| T |
31952404 |
actcaatggatgatggtagaggtccacccaaaagaattagaggaaatcaccaatctcctaatacattggcaagttcttctatttctccccctaacgaggt |
31952305 |
T |
 |
| Q |
104 |
tgctatgagggataatgcaacattgttatctcaaattcatttgctggatcaagtaggacaacttggtaattcatggagcaggttcagtcaatcaattatg |
203 |
Q |
| |
|
||||||| ||| ||||| ||||||| |||||||||||||||||| ||||||||| ||||||||||||||||||||| || ||| || ||||| |
|
|
| T |
31952304 |
tgctatggggggtaatgtaacattgccatctcaaattcatttgctcaatcaagtagaacaacttggtaattcatggagtagaccaggtcggtctcttatg |
31952205 |
T |
 |
| Q |
204 |
gtgaataacggtaataaccatttagttcctgaaaataatttggtgcaacacttttggccaacgcctcatatacaaggtaa |
283 |
Q |
| |
|
|||||||| | ||||| |||||| |||||||||| |||||||||||||||||| ||||| | ||||||||||||||| |
|
|
| T |
31952204 |
gtgaataatgaaaataatcatttaattcctgaaaacaatttggtgcaacactttcaaccaacacttcatatacaaggtaa |
31952125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University