View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9872_low_13 (Length: 297)
Name: NF9872_low_13
Description: NF9872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9872_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 48 - 292
Target Start/End: Original strand, 46229555 - 46229799
Alignment:
| Q |
48 |
gttgctccgcaacaactttctcgcccaatgcctccaccacttatgtgccattggagtgttccgttccacaatgcagtcaggtccgtgggctctcatgtcc |
147 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46229555 |
gttgctccgcaacaactttctcacccaatgcctccaccagttatgtgccattggagtgttccgttccacaatgcagtcaggtccgtgggctctcatgtcc |
46229654 |
T |
|
| Q |
148 |
agccacgggctctggcgcatgttccttcaacaaatcttacgcaggttcgacttactctgccacacttgttcaagattcacttagattagctacggatgtt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46229655 |
agccacgggctctggcgcatgttccttcaacaaatcttacgcaggttcgacttactctgccacacttgttcaagattcacttagattagctacggatgtt |
46229754 |
T |
|
| Q |
248 |
atccctagctactcttttggatccatcaatgctatctctgcttct |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46229755 |
atccctagctactcttttggatccatcaatgctatctctggttct |
46229799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University