View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9872_low_15 (Length: 292)
Name: NF9872_low_15
Description: NF9872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9872_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 18 - 284
Target Start/End: Complemental strand, 12145563 - 12145297
Alignment:
| Q |
18 |
ataaggaacccgccacttggatatttaatatgtatatgataagataatatttttatttcataagaaggtagattgtctttataaaccaacataaattatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12145563 |
ataaggaacccgccacttggatatttaatatgtatatgataagataatatttttatttcataagaaggtagattgtctttataaaccaacataaattatc |
12145464 |
T |
|
| Q |
118 |
agcatcaattacaatttcttaactctagttcataaggaaagggaaatagtaacatgaactttggtccaaggataagtaaaatttagacaaaaattattct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12145463 |
agcatcaattacaatttcttaactctagttcataaggaaagggaaatagtaacatgaactttggtccaaggataagtaaaatttagacaaaaattattct |
12145364 |
T |
|
| Q |
218 |
aattgtggattgaatttattgctcccaaccgatttattgaagttcagcaatcacatcatttttcttg |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12145363 |
aattgtggattgaatttattgctcccaaccgatttattgaagttcagcaatcacatcatttttcttg |
12145297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University