View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9872_low_19 (Length: 266)
Name: NF9872_low_19
Description: NF9872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9872_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 2 - 255
Target Start/End: Complemental strand, 11286201 - 11285948
Alignment:
| Q |
2 |
aacgatgacctattgaacaattttataattgtttgttgatgttagtgtgttaacattcaattttaatgtctttgtgtagcctggtccggaatctattggt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11286201 |
aacgatgacctattgaacaattttataattgtttgttgatgttagtgtgttaacagtcaattttaatgtctttgtgtagcctggtccggaatctattggt |
11286102 |
T |
|
| Q |
102 |
atcgttgctgtttcccgcaactctagtgggatagcggcgcgagcctgcggccttgtgagtctggagcccactaaggtagtattttgttgttgatttgttt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11286101 |
atcgttgctgtttcccgcaactctagtgggatagcggcgcgagcctgtggccttgtgagtctagagcccactaaggtagtattttgttgttgatttgttt |
11286002 |
T |
|
| Q |
202 |
ccttgttgctgttgaacaatgaaactgtgattactttttaataacttgtctgtg |
255 |
Q |
| |
|
||| |||||||| ||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
11286001 |
cctcgttgctgtcgaacaatgaaattgtgattcctttttaataacttgtctgtg |
11285948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University