View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9872_low_24 (Length: 239)
Name: NF9872_low_24
Description: NF9872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9872_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 28 - 224
Target Start/End: Complemental strand, 42184409 - 42184213
Alignment:
| Q |
28 |
ctgaaatgtaagaaaacaaatggctttggagaaataaacaaattaaagttgaactaagttttggtttgcatttctttccttttaatttcttaactaccaa |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42184409 |
ctgaaatgtaagaaaacaaatggctttggagaaataaacaaattaaagttgaactaagttttggtttgcatttctttccttttaatttcttaactaccta |
42184310 |
T |
 |
| Q |
128 |
aacaactgtattcaaccttcaataaagaatggcacatatgttggtgaattgtgattatggtccaaatctactatactgagacattcaaggaatacgt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42184309 |
aacaactgtattcaaccttcaataaagaatggcacatatgttggtgaattgtgattatggtccaaatctactatactgagacattcaaggaatacgt |
42184213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University