View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9872_low_25 (Length: 238)
Name: NF9872_low_25
Description: NF9872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9872_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 46229776 - 46230007
Alignment:
| Q |
1 |
tccatcaatgctatctctggttcttcaattccagcccaaggacttttgggcttgggccgtggcccgttatctttattatcacaaaccgggtcactttact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46229776 |
tccatcaatgctatctctggttcttcaattccagcccaaggacttttgggcttgggccgtggcccgttatctttattatcacaaaccgggtcactttact |
46229875 |
T |
 |
| Q |
101 |
cgggtgtattctcctactgccttccaagtttcaaatcttactatttttccggatcacttaaacttggacccgtgggtcaacccaaaagcattcgaaccac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46229876 |
cgggtgtattctcctactgccttccaagtttcaaatcttactatttttccgggtcacttaaacttggacccgtgggtcaacccaaaagcattcgaaccac |
46229975 |
T |
 |
| Q |
201 |
accacttcttcgcaatccttgatgtccatctc |
232 |
Q |
| |
|
||||||||||||||||||| | ||||||||| |
|
|
| T |
46229976 |
accacttcttcgcaatcctcgccgtccatctc |
46230007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University