View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9872_low_28 (Length: 227)
Name: NF9872_low_28
Description: NF9872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9872_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 2 - 122
Target Start/End: Complemental strand, 4409926 - 4409806
Alignment:
| Q |
2 |
ataaatcaaacagagccaccatatgaaactttacatatatctgtcaaaatcttcaaaaattcaaacatttttgacaacttctttgcaggatttgtagttg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4409926 |
ataaatcaaacagagccaccatatgaaactttacatatatctgtcaaaatcttcaaaaattcaaacatttttgacaacttctttgcaggatttgtagttg |
4409827 |
T |
|
| Q |
102 |
ccttgtcctatgagaacctag |
122 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4409826 |
ccttgtcctatgagaacctag |
4409806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 153 - 224
Target Start/End: Complemental strand, 4409775 - 4409704
Alignment:
| Q |
153 |
gataagcaatgtgattagagtatcattaaatttggtcttaaaagtttaacaatgtaaagaacaaaaccagaa |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4409775 |
gataagcaatgtgattagagtatcattaaatttggtcttaaaagtttaacaatgtaaagaacaaaaccagaa |
4409704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University