View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9872_low_3 (Length: 385)
Name: NF9872_low_3
Description: NF9872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9872_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 13 - 369
Target Start/End: Complemental strand, 28691830 - 28691495
Alignment:
| Q |
13 |
gaacctgtggcctatttaggtatgctgcagtataatctgatgcacatggatcatatcctgctagatttttatgccacccgtcctattaaaatcgacaatt |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28691830 |
gaacctctggcctatttaggtatgctgcagtataatctgatgcacatggatcatatcctgctagatttttatgccacccgtcctattaaaattgacaatt |
28691731 |
T |
 |
| Q |
113 |
tcaataggcaagtaactttagttgctgtagtatacgtgtactagtttttaagttctaaattgatgaattaactcaccagtaccaatttggaaaaagaaga |
212 |
Q |
| |
|
|||||||||||||||| |||||||| ||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28691730 |
tcaataggcaagtaacgttagttgcagtagt------gtactagtttttaagttctaaattgatgaa---actcaccagtaccaatttggaaaaagaa-- |
28691642 |
T |
 |
| Q |
213 |
atgaggggcttcccttctgacgttgctgatattgctgaaacacatgggagcgtacaagctatacatgtctataatcttatacacatcaaagtatttatta |
312 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28691641 |
-tga---------cttctgacgttgctgatattgctgaaacacatgggagcgtacaagctatacatgtctataatcttatacacatcgaagtatttatta |
28691552 |
T |
 |
| Q |
313 |
agttctgtattgcattcatctgtttgattttgaattggatggctgaagttgcatatg |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28691551 |
agttctgtattgcattcatctgtttgattttgaattggatggctgaagttgcatatg |
28691495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University