View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9872_low_4 (Length: 365)
Name: NF9872_low_4
Description: NF9872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9872_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 306; Significance: 1e-172; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 1 - 362
Target Start/End: Complemental strand, 4075542 - 4075181
Alignment:
| Q |
1 |
ttgttacaaagaaagagatcaaattacagaagatggatatagtggaaatggttctgttcctaaaatgatgcaagtggttgaaaatgttctagaagatttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
4075542 |
ttgttacaaagaaagagatcaaattaaagaagagggatatagtggaaatggttctgttcctaaaatgatgcaagtggtggaaaatgttctacaagatttg |
4075443 |
T |
|
| Q |
101 |
aaaactagaggtttgaatgttcaattgcttaacatcacacagctatcagagtacagaaaagaaggccatccatctatctataggaagcaatgggagcctt |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4075442 |
aaaagaagaggtttgaatgttcaattgcttaacataacacaactctcagagtacagaaaagaaggtcatccatctatctataggaagcaatgggagcctc |
4075343 |
T |
|
| Q |
201 |
taacagaagagcaaatatcaaatccaaaatcttatgcagattgcatacattggtgtctccctggtgtgcctgatacttggaatgagcttctttatgccta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4075342 |
taacagaagagcaaatatcaaatccaaaatcttatgcagattgcatacattggtgtctccctggtgtgcctgatacttggaatgagcttctttatgccta |
4075243 |
T |
|
| Q |
301 |
tattttccatagatgacaaacatttgatattgaaaactttaagtacaatacgttacatttat |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||| |
|
|
| T |
4075242 |
tattttccatagatgacaaacatttgatattgaaaacttgaagtaaaatatgttacatttat |
4075181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 234 - 283
Target Start/End: Original strand, 5232904 - 5232953
Alignment:
| Q |
234 |
atgcagattgcatacattggtgtctccctggtgtgcctgatacttggaat |
283 |
Q |
| |
|
|||| ||||| |||||||||||| | |||||||| ||||||||||||||| |
|
|
| T |
5232904 |
atgctgattgtatacattggtgtttgcctggtgttcctgatacttggaat |
5232953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 109; Significance: 9e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 59 - 307
Target Start/End: Original strand, 25824676 - 25824924
Alignment:
| Q |
59 |
cctaaaatgatgcaagtggttgaaaatgttctagaagatttgaaaactagaggtttgaatgttcaattgcttaacatcacacagctatcagagtacagaa |
158 |
Q |
| |
|
|||||||||||||||||||| || || || || || ||||||||||| | |||||| ||||||||| |||||||||||||||| || ||||| ||||||| |
|
|
| T |
25824676 |
cctaaaatgatgcaagtggtggagaaggtgcttgatgatttgaaaacaaaaggtttaaatgttcaaatgcttaacatcacacaactctcagaatacagaa |
25824775 |
T |
|
| Q |
159 |
aagaaggccatccatctatctataggaagcaatgggagcctttaacagaagagcaaatatcaaatccaaaatcttatgcagattgcatacattggtgtct |
258 |
Q |
| |
|
||||||| || || |||||||||||||| || ||||| ||| |||| |||| || |||||||||||||| |||||||||||||||||||||||| || |
|
|
| T |
25824776 |
aagaaggtcacccttctatctataggaaacagtgggaacctctaactcaagaacagatatcaaatccaaatggttatgcagattgcatacattggtgcct |
25824875 |
T |
|
| Q |
259 |
ccctggtgtgcctgatacttggaatgagcttctttatgcctatattttc |
307 |
Q |
| |
|
|| || || |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25824876 |
accaggagttcctgatgtatggaatgagcttctttatgcctatattttc |
25824924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 248 - 297
Target Start/End: Original strand, 37804102 - 37804151
Alignment:
| Q |
248 |
cattggtgtctccctggtgtgcctgatacttggaatgagcttctttatgc |
297 |
Q |
| |
|
|||||||||||||||||||| || ||| | ||||||||| |||||||||| |
|
|
| T |
37804102 |
cattggtgtctccctggtgttcccgattcgtggaatgagattctttatgc |
37804151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 239 - 286
Target Start/End: Complemental strand, 19411880 - 19411833
Alignment:
| Q |
239 |
gattgcatacattggtgtctccctggtgtgcctgatacttggaatgag |
286 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
19411880 |
gattgcagtcattggtgcctccctggtgtgcctgatatttggaatgag |
19411833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 239 - 286
Target Start/End: Complemental strand, 50750203 - 50750156
Alignment:
| Q |
239 |
gattgcatacattggtgtctccctggtgtgcctgatacttggaatgag |
286 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
50750203 |
gattgcagccattggtgcctccctggtgtgcctgatatttggaatgag |
50750156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 251 - 297
Target Start/End: Original strand, 7821871 - 7821917
Alignment:
| Q |
251 |
tggtgtctccctggtgtgcctgatacttggaatgagcttctttatgc |
297 |
Q |
| |
|
|||||||| |||||||| |||||||| ||||||||||| |||||||| |
|
|
| T |
7821871 |
tggtgtcttcctggtgtacctgatacatggaatgagctactttatgc |
7821917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 248 - 297
Target Start/End: Original strand, 7812337 - 7812386
Alignment:
| Q |
248 |
cattggtgtctccctggtgtgcctgatacttggaatgagcttctttatgc |
297 |
Q |
| |
|
||||||||||| || ||||| |||||||| ||||||||||| |||||||| |
|
|
| T |
7812337 |
cattggtgtcttcccggtgtacctgatacatggaatgagctactttatgc |
7812386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 239 - 283
Target Start/End: Original strand, 15113355 - 15113399
Alignment:
| Q |
239 |
gattgcatacattggtgtctccctggtgtgcctgatacttggaat |
283 |
Q |
| |
|
||||||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
15113355 |
gattgcagccattggtgtctgcctggtgttcctgatacttggaat |
15113399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 237 - 285
Target Start/End: Original strand, 25962716 - 25962764
Alignment:
| Q |
237 |
cagattgcatacattggtgtctccctggtgtgcctgatacttggaatga |
285 |
Q |
| |
|
||||||||| ||||||||||| |||||| | ||||||||||||||||| |
|
|
| T |
25962716 |
cagattgcagtcattggtgtcttcctggtttacctgatacttggaatga |
25962764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University