View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9873_1D_high_14 (Length: 277)

Name: NF9873_1D_high_14
Description: NF9873_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9873_1D_high_14
NF9873_1D_high_14
[»] chr6 (1 HSPs)
chr6 (78-183)||(2353840-2353945)


Alignment Details
Target: chr6 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 78 - 183
Target Start/End: Complemental strand, 2353945 - 2353840
Alignment:
78 tttggtgtttggtcagacatatataaacatgaggtagacctttttagctcagttaatcaaaattaccgaattaaaaagtgaacgattcctaacaccatgt 177  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2353945 tttggagtttggtcagacatatataaacatgaggtagacctttttagctcagttaatcaaaattaccgaattaaaaagtgaacgattcctaacaccatgt 2353846  T
178 agcaat 183  Q
    ||||||    
2353845 agcaat 2353840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University