View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9873_1D_high_16 (Length: 252)

Name: NF9873_1D_high_16
Description: NF9873_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9873_1D_high_16
NF9873_1D_high_16
[»] scaffold0002 (1 HSPs)
scaffold0002 (83-244)||(343058-343219)


Alignment Details
Target: scaffold0002 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 83 - 244
Target Start/End: Original strand, 343058 - 343219
Alignment:
83 caatgttggagttgagacaggtgaactttttggtggttgaggtggtgggacttttgggcttgaagctggtgcaatttttggagctggtgatgtaactgga 182  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
343058 caatgttggagttgagacaggtgaactttttggtggttgaggtggtgggacttttgggcttgaagctggtgcaatttttggagctggtgatgtaactgga 343157  T
183 gcagatttaggtgccacagttacaggcggttggcttgtgatgggaggagatgccaccacggt 244  Q
    |||||||| |||||||| || ||||| |||||||||||||||||||||||||||||||||||    
343158 gcagatttgggtgccacggtaacaggtggttggcttgtgatgggaggagatgccaccacggt 343219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University