View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_1D_high_17 (Length: 249)
Name: NF9873_1D_high_17
Description: NF9873_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_1D_high_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 5 - 244
Target Start/End: Complemental strand, 38677610 - 38677373
Alignment:
| Q |
5 |
attattctaaaacactttgattttctcttaatcggattattatatatttcttgagttgcaagttaagcaaggatttttaaaaaaccacaatgcaatcccc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38677610 |
attattctaaaacactttgattttctcttaatcggattattatatatttcttgagttgcaagttaagcaaggatttttaaaaaaccacaatgcaatcccc |
38677511 |
T |
|
| Q |
105 |
tttcttgccgctattgttcacttcaattttgggggtattgtaaacgaattgcatactgttgtattttaatttcttgatgatactttttatcttttgattc |
204 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38677510 |
tttcttgcggctattgttcacttcaattttgggggtattgtaaatgaa--gcatactgttgtattttaatttcttgatgatactttttatcttttgattc |
38677413 |
T |
|
| Q |
205 |
tgatatcagtgttctgtgacattttgttcaatgggttaat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38677412 |
tgatatcagtgttctgtgacattttgttcaatgggttaat |
38677373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University