View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_1D_high_22 (Length: 215)
Name: NF9873_1D_high_22
Description: NF9873_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_1D_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 12 - 210
Target Start/End: Original strand, 5467323 - 5467521
Alignment:
| Q |
12 |
atgaactaggagatcacattaatttgattatcaagtgccaactacaaacataatgacccataatggttgcaaaatacttggtgggtcccatatgaagcac |
111 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5467323 |
atgaaccaggagatcacattaatttgattttcaagtgccaactacaaacataatgacccataatggttgcaaaatacttggtgggtcccatatgaagcac |
5467422 |
T |
 |
| Q |
112 |
gctagaaacctaattaacgattgtttatcccatgatcatgatatccctaacacaaaattgttccctcactcacgcttatatattatcaatgatccctct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5467423 |
gctagaaacctaattaacgattgtttatcccatgatcatgatatccctaacacaaaattgttccctcactcacgcttatatactatcaatgatccctct |
5467521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University