View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9873_1D_high_22 (Length: 215)

Name: NF9873_1D_high_22
Description: NF9873_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9873_1D_high_22
NF9873_1D_high_22
[»] chr1 (1 HSPs)
chr1 (12-210)||(5467323-5467521)


Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 12 - 210
Target Start/End: Original strand, 5467323 - 5467521
Alignment:
12 atgaactaggagatcacattaatttgattatcaagtgccaactacaaacataatgacccataatggttgcaaaatacttggtgggtcccatatgaagcac 111  Q
    |||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5467323 atgaaccaggagatcacattaatttgattttcaagtgccaactacaaacataatgacccataatggttgcaaaatacttggtgggtcccatatgaagcac 5467422  T
112 gctagaaacctaattaacgattgtttatcccatgatcatgatatccctaacacaaaattgttccctcactcacgcttatatattatcaatgatccctct 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
5467423 gctagaaacctaattaacgattgtttatcccatgatcatgatatccctaacacaaaattgttccctcactcacgcttatatactatcaatgatccctct 5467521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University