View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_1D_high_24 (Length: 213)
Name: NF9873_1D_high_24
Description: NF9873_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_1D_high_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 6 - 169
Target Start/End: Original strand, 676435 - 676598
Alignment:
| Q |
6 |
tggagttagttaacaaaggtaacaaattttgatgaaagccctatttgtatatgtactactataacatgtcctacatattgctcttgacattctttagtgg |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
676435 |
tggagttagctaacaaaggtaacaaattttgatgaaagccctatttgtatatgtactactataacatgtcctacatattgctcttgacattctttagtgg |
676534 |
T |
 |
| Q |
106 |
cttttttctgatctattctttctttgagtaacaaattatctttcttctttaatcttaccctaaa |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
676535 |
cttttttctgatctattctttctttgagtaacaaattatctttcttctttaatcttaccctaaa |
676598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University