View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_1D_high_26 (Length: 205)
Name: NF9873_1D_high_26
Description: NF9873_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_1D_high_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 16012578 - 16012387
Alignment:
| Q |
1 |
aaaaacataaaattaagtaagtggagcacctaagaaacataatatttagtatatcatatcaagttat-aatcattttgaaattcatattgcagatatgta |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16012578 |
aaaaacataaaattaagtaagtggagcacctaagcaacataatatttagtatatcatatcaagttattaatcattttgaaattcatattgcagatatgta |
16012479 |
T |
|
| Q |
100 |
aactactatataaattcaatggctacataatccctagaatgatgatgtccagtgaaaaatgaagaacaaacacttaaaacctattcaaacac |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16012478 |
aactactatataaattcaatggctacataatccctagaatgatgatgtccagtgaaaaatgaagaacaaacacttaaaacctattcaaacac |
16012387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University