View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_1D_low_13 (Length: 303)
Name: NF9873_1D_low_13
Description: NF9873_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_1D_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 50 - 301
Target Start/End: Original strand, 9738699 - 9738954
Alignment:
| Q |
50 |
atcatgatgaatgataatatgcatgttactatccaaacttcaaccgaaacccatcgatatcgcattgcttaacacaatcatgtgctcaacatgaagaaga |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9738699 |
atcatgatgaatgataatatgcatgttactatccaaacttcaaccgaaacccatcgatatcgcattgcttaacacaatcatgtgctcaacatgaagaagg |
9738798 |
T |
 |
| Q |
150 |
gaaattcttgatatagaatgtgtcatgtgact----cgtacaactcccaaacttatgaactatattactatagatgaataatgaattgcacacatagtat |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
9738799 |
gaaattcttgatatagaatgtgtcatgtgactcgtacgtacaactcccaaacttatgaactatattactatatatgaataatgaagtgcacacatagtat |
9738898 |
T |
 |
| Q |
246 |
tcatataggaagtaggggaaattctatcagaattaaccttcatgtttaatggaccc |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9738899 |
tcatataggaagtaggggaaattctatcagaattaaccttcatgttcaatggaccc |
9738954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University