View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_1D_low_17 (Length: 277)
Name: NF9873_1D_low_17
Description: NF9873_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_1D_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 78 - 183
Target Start/End: Complemental strand, 2353945 - 2353840
Alignment:
| Q |
78 |
tttggtgtttggtcagacatatataaacatgaggtagacctttttagctcagttaatcaaaattaccgaattaaaaagtgaacgattcctaacaccatgt |
177 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2353945 |
tttggagtttggtcagacatatataaacatgaggtagacctttttagctcagttaatcaaaattaccgaattaaaaagtgaacgattcctaacaccatgt |
2353846 |
T |
 |
| Q |
178 |
agcaat |
183 |
Q |
| |
|
|||||| |
|
|
| T |
2353845 |
agcaat |
2353840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University