View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_1D_low_18 (Length: 275)
Name: NF9873_1D_low_18
Description: NF9873_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_1D_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 80 - 181
Target Start/End: Original strand, 38410828 - 38410929
Alignment:
| Q |
80 |
tggtgttcccaaaattgctaatgttatgtgtgttgttgttgctctcaatgcacaacgttcttggatcgcaccatcgccatgtgagtattgttaacaagtt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38410828 |
tggtgttcccaaaattgctaatgttatgtgtgttgttgttgctctcaatgcacaacgttcttggatcgcacaatcgccatgtgagtattgttaacaagtt |
38410927 |
T |
|
| Q |
180 |
gg |
181 |
Q |
| |
|
|| |
|
|
| T |
38410928 |
gg |
38410929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 104 - 145
Target Start/End: Original strand, 38403259 - 38403300
Alignment:
| Q |
104 |
tatgtgtgttgttgttgctctcaatgcacaacgttcttggat |
145 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
38403259 |
tatgtgtgttggtgttgctttcaatgcacaacgttcttggat |
38403300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University