View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_1D_low_21 (Length: 252)
Name: NF9873_1D_low_21
Description: NF9873_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_1D_low_21 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 83 - 244
Target Start/End: Original strand, 343058 - 343219
Alignment:
| Q |
83 |
caatgttggagttgagacaggtgaactttttggtggttgaggtggtgggacttttgggcttgaagctggtgcaatttttggagctggtgatgtaactgga |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
343058 |
caatgttggagttgagacaggtgaactttttggtggttgaggtggtgggacttttgggcttgaagctggtgcaatttttggagctggtgatgtaactgga |
343157 |
T |
 |
| Q |
183 |
gcagatttaggtgccacagttacaggcggttggcttgtgatgggaggagatgccaccacggt |
244 |
Q |
| |
|
|||||||| |||||||| || ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
343158 |
gcagatttgggtgccacggtaacaggtggttggcttgtgatgggaggagatgccaccacggt |
343219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University