View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_1D_low_24 (Length: 238)
Name: NF9873_1D_low_24
Description: NF9873_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_1D_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 9 - 236
Target Start/End: Original strand, 44617280 - 44617508
Alignment:
| Q |
9 |
taaattggagtaaatgttctacacat-gagcagggtgtacagtaataaaaccaagccacctagaaatatcgtatcaatttttgcgaaatagtcgcatcat |
107 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| || |
|
|
| T |
44617280 |
taaattggagtaaatgttctgcacattgagcagggtgtaccgtaataaaaccaagccacctagaaatatcatatcaatttttgtgaaatagtcgcatgat |
44617379 |
T |
 |
| Q |
108 |
agaaaaagatgagcaatgtccttctccgatttgccacaaccacccgcacaatgctgcacattaggctaaagaactcacctcctggttaaattatttgtct |
207 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44617380 |
agaaaaagatgagcaatgtcctccttcgatttgccacaaccacccacacaatgctgcacattaggctaaagaactcacctcctggttaaattattcgtct |
44617479 |
T |
 |
| Q |
208 |
tagggatacaattacgaagcaaacaccaa |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44617480 |
tagggatacaattacgaagcaaacaccaa |
44617508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University