View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_1D_low_32 (Length: 213)
Name: NF9873_1D_low_32
Description: NF9873_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_1D_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 6 - 200
Target Start/End: Original strand, 39620213 - 39620407
Alignment:
| Q |
6 |
acttatcacttatcattaaaggaagtaaaaacttactggtggtgggacaacagttcctgagaaaagattccataatacataggacggacgggtaaggaaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39620213 |
acttatcacttatcattaaaggaagtaaaaacttactggtggtgggacaacagttcctgagaaaagattccataatacataggacggacgggtaaggaaa |
39620312 |
T |
|
| Q |
106 |
gagacaatggtttggtttggggttatagccattgtcatcatgccgtagtaggtacagtatagggaggtgaagaaaacaaaaaatatgtaccagaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39620313 |
gagacaatggtttggtttggggttatagctattgtcatcatgccgtagtaggtacagtatagggaggtgaagaaaacaaaaaatatgtaccagaa |
39620407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University