View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_1D_low_36 (Length: 206)
Name: NF9873_1D_low_36
Description: NF9873_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_1D_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 9 - 200
Target Start/End: Complemental strand, 21592882 - 21592691
Alignment:
| Q |
9 |
gatatgaaggttcaaggagaaagcctaacagatatgacttgcacaatcgccgatgggaatgggaagatgctcctcaaagggaagaaactccatggcatac |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21592882 |
gatatgaaggttcaaggagaaagcctaacagatatgacttgcacaatcgccgatgggaatgggaagatgctcctcaaagggaagaaactccatggcatac |
21592783 |
T |
 |
| Q |
109 |
tccttgttcgtcctttaattcactttctcctttggatcatgtttctccgtctccttttccaatacgggcttctggctcttcacgcaaatctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21592782 |
tccttgttcgtcctttaattcactttctcctttggatcatgtttctccgtctccttttccaatacgggcttctggctcttcacacaaatctt |
21592691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 124 - 200
Target Start/End: Original strand, 42095134 - 42095210
Alignment:
| Q |
124 |
taattcactttctcctttggatcatgtttctccgtctccttttccaatacgggcttctggctcttcacgcaaatctt |
200 |
Q |
| |
|
|||||||| |||||||| ||| |||||||||||||||||| |||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
42095134 |
taattcaccttctccttgggaccatgtttctccgtctcctgttccaatacgagcttccggctcttcagtcaaatctt |
42095210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University