View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9873_2D_high_7 (Length: 334)

Name: NF9873_2D_high_7
Description: NF9873_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9873_2D_high_7
NF9873_2D_high_7
[»] chr1 (1 HSPs)
chr1 (1-317)||(45104690-45105006)


Alignment Details
Target: chr1 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 1 - 317
Target Start/End: Original strand, 45104690 - 45105006
Alignment:
Q  1 tgatttctcccaacgacgaatggggaaactggacggctttattcgcagctgcggctttcggaatctggtcggagaagacggagattgggaaaacagtgag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45104690 tgatttctcccaacgacgaatggggaaactggacggctttattcgcagctgcggctttcggaatctggtcggagaagacggagattgggaaaacagtgag 45104789  T
Q  101 tggagctattgtgagtattttggtgtgtcttgctgctagtaatttggggattctttctgttaatgctcctgcttatgacttggttctgaagtttcttctt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45104790 tggagctattgtgagtattttggtgtgtcttgctgctagtaatttggggattctttctgttaatgctcctgcttatgacttggttctgaagtttcttctt 45104889  T
Q  201 cctctcgccattcccttgcttctctttagggctgatcttcgacgagttataagttccactggcacacttctcttgcctttcttgcttggttctggtaact 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45104890 cctctcgccattcccttgcttctctttagggctgatcttcgacgagttataagttccactggcacacttctcttgcctttcttgcttggttctggtaact 45104989  T
Q  301 cacttctctcctttttc 317  Q
    |||||||||||||||||    
T  45104990 cacttctctcctttttc 45105006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University