View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_2D_low_11 (Length: 348)
Name: NF9873_2D_low_11
Description: NF9873_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_2D_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 7e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 82 - 160
Target Start/End: Complemental strand, 22192685 - 22192607
Alignment:
| Q |
82 |
aactttaatttacaattgaaatacttacatatcccctttaagagagagactatttgcatatgtgatatgttggcatagc |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22192685 |
aactttaatttacaattgaaatacttacatatcccctttaagagagagactatttgcatatgtgatatgttggcatagc |
22192607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 12 - 63
Target Start/End: Complemental strand, 22192736 - 22192685
Alignment:
| Q |
12 |
ctttagacattgagtatattggttatctcatttatatgtttttcaacaacta |
63 |
Q |
| |
|
||||| |||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22192736 |
ctttatacattgggtatattggttatctcacttatatgtttttcaacaacta |
22192685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 6 - 58
Target Start/End: Original strand, 13091833 - 13091885
Alignment:
| Q |
6 |
caaatcctttagacattgagtatattggttatctcatttatatgtttttcaac |
58 |
Q |
| |
|
|||| |||| ||||||||||| ||| |||| ||||||||||||||| |||||| |
|
|
| T |
13091833 |
caaaaccttaagacattgagtttatgggttctctcatttatatgttgttcaac |
13091885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University