View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_2D_low_16 (Length: 314)
Name: NF9873_2D_low_16
Description: NF9873_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_2D_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 246; Significance: 1e-136; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 24 - 293
Target Start/End: Original strand, 11909032 - 11909301
Alignment:
| Q |
24 |
gctacatgtgtgtgaacactacaaatgcctaactccttagtaattttctgatttacggtgatgcatataagaaacggtaggaggtagaaatgatcaggca |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11909032 |
gctacatgtgtgtgaacactacaaatgcctaactccttagtaattttctgatttatggtgatgcatataagaaacggtaggaggcagaaatgatcaggca |
11909131 |
T |
 |
| Q |
124 |
attgctgaagccttggcagcgatggcatccaaatcagcagggaagtaacgatgagttccgagcactgggaagatttcaaggggaggtacgatcctcgagg |
223 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
11909132 |
attgctgaagccttgccagcgatggcatccaaatcagcagggaagtaacgacgagttccgagcaccgtgaagatttcaaggggaggtacgatcctcgagg |
11909231 |
T |
 |
| Q |
224 |
tgctcagatttggatccaagcgattgagaagatttacataatgatgatgttccctgatgcatataaggtg |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11909232 |
tgctcagatttggatccaagcgattgagaagatttacataatgatgatgttccctgatgcatataaggtg |
11909301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 228 - 293
Target Start/End: Complemental strand, 11918597 - 11918532
Alignment:
| Q |
228 |
cagatttggatccaagcgattgagaagatttacataatgatgatgttccctgatgcatataaggtg |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11918597 |
cagatttggatccaagcgattgagaagatttacataatgatgatgttccctgatgcatataaggtg |
11918532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 46 - 147
Target Start/End: Original strand, 11777347 - 11777447
Alignment:
| Q |
46 |
aaatgcctaactccttagtaattttctgatttacggtgatgcatataagaaacggtaggaggtagaaatgatcaggcaattgctgaagccttggcagcga |
145 |
Q |
| |
|
||||||||||||| | | ||||| ||||||| ||||||||| |||||||| ||| ||||||||||||||||||||||| | |||||||| | ||||| |
|
|
| T |
11777347 |
aaatgcctaactcttaaataattgtctgattct-ggtgatgcagataagaaaaggttagaggtagaaatgatcaggcaattaccgaagcctttgtagcga |
11777445 |
T |
 |
| Q |
146 |
tg |
147 |
Q |
| |
|
|| |
|
|
| T |
11777446 |
tg |
11777447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University