View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_2D_low_25 (Length: 272)
Name: NF9873_2D_low_25
Description: NF9873_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_2D_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 4 - 270
Target Start/End: Complemental strand, 41732477 - 41732211
Alignment:
| Q |
4 |
gtcaatgagattatcattattaaggtgagcttctaaacacgtgaaacagattatatatctctctttgtgaagaaacacaccaaaacatgtttttagatag |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41732477 |
gtcaatgagattatcattattaaggtgagcttctaaacacgtgaaacagattatatatctctctttgtgaagaaacacaccaaaacatgtttttagatag |
41732378 |
T |
 |
| Q |
104 |
caagtaatctgaaagaaaatgaatggcatgaggaaacagttcaccggtatgcccacaattgtctctttctaattgtctctttctaatgagacattgtctt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41732377 |
caagtaatctgaaagaaaatgaatggcatgaggaaacagttcaccggtatgcccacaattgtctctttctaattgtctctttctaatgagacattgtctt |
41732278 |
T |
 |
| Q |
204 |
taggcactggtccattggaataaatgtcgaaaccagaaaaatacaaactactatgtaaactgtatgt |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41732277 |
taggcactggtccattggaataaatgtcgaaaccagaaaaatacaaactactatgtaaactgtatgt |
41732211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University