View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_2D_low_26 (Length: 262)
Name: NF9873_2D_low_26
Description: NF9873_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_2D_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 47116867 - 47117081
Alignment:
| Q |
1 |
tacaatagttatattttatcaaagatattcaataaccaatttcttttatatctttagtttcaattcaaggagataaatattcataccttttaacgatcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116867 |
tacaatagttatattttatcaaagatattcaataaccaatttcttttatatctttagtttcaattcaaggagataaatattcataccttttaacgatcaa |
47116966 |
T |
 |
| Q |
101 |
atcacaaagcaaggtaagcaatatcaacgtatcaatgactcgatcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcggag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116967 |
atcacaaagcaaggtaagcaatatcaacgtatcaatgac----tcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcggag |
47117062 |
T |
 |
| Q |
201 |
aatgtatgataggcaacaa |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
47117063 |
aatgtatgataggcaacaa |
47117081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 215 - 251
Target Start/End: Complemental strand, 47116801 - 47116765
Alignment:
| Q |
215 |
aacaagggtatgaggaagcttggagtgatgtccatct |
251 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47116801 |
aacaagggtatgaggaagcttggagtggtgtccatct |
47116765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University