View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_high_3 (Length: 557)
Name: NF9873_high_3
Description: NF9873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 280; Significance: 1e-156; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 280; E-Value: 1e-156
Query Start/End: Original strand, 143 - 541
Target Start/End: Original strand, 39010390 - 39010786
Alignment:
| Q |
143 |
taattagcagttagtattatatagataaatttttacttaatcaaattattgatgnnnnnnnnnnnnnnnnnnnattgcggtggttttaagttgcaagaca |
242 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39010390 |
taattaacagttagtattatatagataaatttttacttaatcaaattattgatgtttttttttattttttt--attgcggtggttttaagttgcaagaca |
39010487 |
T |
|
| Q |
243 |
cttcttctttaaannnnnnnnnnngcaagatatggctatgacacatgaaaatattggacctgctccctctgcattcacatattcaagaagtctacaacta |
342 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39010488 |
cttcttttttaaaaaaataaaattgcaagatatggctatgacacatgaaaatattggacctgctccctctgcatttacatattcaagaagtctacaacta |
39010587 |
T |
|
| Q |
343 |
tttgataaagattagacagagtttgaattataatcaaaattaaatcctttttgttttgacaatccgatcaagatctctcaactccatcgaatttcatttc |
442 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39010588 |
tttgataaagattagacagagtttgaattataatcaaaattaaatcttttttgttttgacaatccgatcaagatctctcaactccatcgaatttcgtttc |
39010687 |
T |
|
| Q |
443 |
ataatcatttaagcactccacctaattaatatttagggaaaattacacaaatctctcttgaactttggttaaatgtcacatgttttttcatgttctttc |
541 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39010688 |
ataattatttaagcactccacctaattaatatttagggaaaattacacaaatctctcttgaactttggttaaatgtcacatgttttttcatgttctttc |
39010786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University