View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_high_39 (Length: 333)
Name: NF9873_high_39
Description: NF9873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_high_39 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
| [»] scaffold0607 (2 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 13 - 333
Target Start/End: Original strand, 21703763 - 21704083
Alignment:
| Q |
13 |
cagagatgcattgtgacaaaatcaactttagtctatttgaaaggacctttgaaataaacttgtacaaaacattacacagagaaattggacaccaatcctt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21703763 |
cagagatgcattgtgacaaaatcaactttagtctatttgcaaggatctttgaaatcaacttgtacaaaacattacatagagaaattggacaccaatcctt |
21703862 |
T |
|
| Q |
113 |
cattgttgtctgaatattttctttaggaataagagtggtgtctgtcatatatagatcagcgggaaactaacccgtatccaaccaacgataacattcagaa |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| | ||| |||||||||||||||| ||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
21703863 |
cattgttgtctgaatatttcctttaggaataagagcgatgtttgtcatatatagatcaacgggaaactgacccgtatccaaccaacgacaacattcagaa |
21703962 |
T |
|
| Q |
213 |
aaaatattatcgccacacaattcccaaaaatgctgatagaaaccggggttaaaaccatcttcccttggacacttgtcaagatggatagagaacattgcag |
312 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| ||| |||||||||||| |
|
|
| T |
21703963 |
aaaatattatcgccacacaattcctaaaaatgctgatagaaaccggggttaaaaccatctgcccttggacacttgtcaggatgcatacagaacattgcag |
21704062 |
T |
|
| Q |
313 |
ttttaaattcatcctttgtga |
333 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
21704063 |
ttttaaattcatcctttgtga |
21704083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 54 - 115
Target Start/End: Original strand, 11606720 - 11606781
Alignment:
| Q |
54 |
aggacctttgaaataaacttgtacaaaacattacacagagaaattggacaccaatccttcat |
115 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||| || | |||||| | |||||||||||| |
|
|
| T |
11606720 |
aggacctttgaaataagcttatacaaaacattacatagcgcaattggtctccaatccttcat |
11606781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0607 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: scaffold0607
Description:
Target: scaffold0607; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 234 - 272
Target Start/End: Complemental strand, 214 - 176
Alignment:
| Q |
234 |
tcccaaaaatgctgatagaaaccggggttaaaaccatct |
272 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
214 |
tcccaaaaatgttgatagaaacctgggttaaaaccatct |
176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0607; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 234 - 272
Target Start/End: Complemental strand, 6152 - 6114
Alignment:
| Q |
234 |
tcccaaaaatgctgatagaaaccggggttaaaaccatct |
272 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
6152 |
tcccaaaaatgttgatagaaacctgggttaaaaccatct |
6114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 234 - 272
Target Start/End: Original strand, 46093225 - 46093263
Alignment:
| Q |
234 |
tcccaaaaatgctgatagaaaccggggttaaaaccatct |
272 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
46093225 |
tcccaaaaatgttgatagaaacctgggttaaaaccatct |
46093263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University