View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_high_5 (Length: 544)
Name: NF9873_high_5
Description: NF9873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 508; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 508; E-Value: 0
Query Start/End: Original strand, 18 - 537
Target Start/End: Original strand, 39014015 - 39014534
Alignment:
| Q |
18 |
ataaatacctttcaaggagtttacgtctctcatcgttgtcagaagcaaagtcaagcatttccttataccattcttgtctgagctcttcccagtagcttct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39014015 |
ataaatacctttcaaggagtttacgtctctcatcgttgtcagaagcaaagtcaagcatttccttataccattcttgtctgagctcttcccagtagcttct |
39014114 |
T |
 |
| Q |
118 |
aggccgggaaataggactcgcccagtcataacttgcgctaatttcatcataattatagtcactgcactctttctcttctaacatttcattgtaataattg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39014115 |
aggccgggaaataggactcgcccagtcataacttgcgctaatttcatcataattatagtcactgcactctttctcttctaacatttcattgtaataattg |
39014214 |
T |
 |
| Q |
218 |
gtttcaatagtttcatataattgttggtctcttgcctcgactttatcagttatatcatttgcgtttgagtcaaccttggatgataattccacaggaattt |
317 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39014215 |
gtttcaatagtatcatataattgttggtctcttgcctcgactttatcagttatatcatttgcgtttgagtcaaccttggatgataattccacaggaattt |
39014314 |
T |
 |
| Q |
318 |
cttttggaccgtgattttgagggtcaaaaccataaattatatgggcttcttctttgatatctgccctagtttgagaaactacattcagtttatttttctt |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39014315 |
cttttggaccgtgattttgagggtcaaaaccataaattatacgggcttcttctttgatatctgccctagtttgagaaactacattcagtttatttttctt |
39014414 |
T |
 |
| Q |
418 |
agtgtggatgttagtgactatcttgctgcaaacaatttctttgttaagttgattagtagtgtgaaatttattcaattgtgcggtattgtttatggtctcc |
517 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39014415 |
agtgtggatgttagtgactatcttgctgcaaacaatttctttgttaagttgattagtagtgtgaaatttattcaattgtgcggtattgtttatggtctcc |
39014514 |
T |
 |
| Q |
518 |
ctgtctatacttctctgctc |
537 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
39014515 |
ctgtctatacttctcggctc |
39014534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University