View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_high_65 (Length: 249)
Name: NF9873_high_65
Description: NF9873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_high_65 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 12 - 249
Target Start/End: Original strand, 28267213 - 28267451
Alignment:
| Q |
12 |
aaaggcaaaaatataaaaggggggcatataagacaataaacaaggcgcgagtgcgcatattcgcggcgcagtcctcgcgataatttaaaagaagcgcca- |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28267213 |
aaaggcaaaaatataaaaggggggcatataagacaataaacaaggcgcgagtgcgcatattcgcggcgcagtcctcgcgataatttaaaagaagcgccat |
28267312 |
T |
|
| Q |
111 |
tttttattttccnnnnnnnggaaaatgtacgatctacggcttgcgtaatcgcattaccacgcgtcagcaatgcaacggtgattgacacgaacttcaacat |
210 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28267313 |
tttttattttccaaaaaaaggaaaatgtacgatctacggcttgcgtaaacgcattaccacgcgtcagcaatgcaacggtgatcaacacgaacttcaacat |
28267412 |
T |
|
| Q |
211 |
acgaatatcctttccgaaatgtcaatcccttattggtcc |
249 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28267413 |
acgaatatcctttccgaaatgtcaatctcttattggtcc |
28267451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University