View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_high_80 (Length: 232)
Name: NF9873_high_80
Description: NF9873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_high_80 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 14 - 216
Target Start/End: Complemental strand, 50613687 - 50613485
Alignment:
| Q |
14 |
caaaggcaaactatcatagcaatatttcaccaagcaactatgatggcagcnnnnnnncagtatggcagaagatttggaaaaagctaaaaagagataagaa |
113 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50613687 |
caaagacaaattatcatagcaatatttcaccaagcaactatgatggtagcaaaaaaacagtatggcagaagatttggaaaaagctaaaaagagataagaa |
50613588 |
T |
 |
| Q |
114 |
gaaagttttcaattctccttctccttctactatagttgaagatggtgtatcatatgatcaagatacatactcaatgaattttgatcatggaacaggttgg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50613587 |
gaaagttttcaattctccttctccttctactatagttgaagatggtgtatcatatgatcaagatacatactcaatgaattttgatcatggaacaggttgg |
50613488 |
T |
 |
| Q |
214 |
atg |
216 |
Q |
| |
|
||| |
|
|
| T |
50613487 |
atg |
50613485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University