View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_high_82 (Length: 230)
Name: NF9873_high_82
Description: NF9873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_high_82 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 24620843 - 24620979
Alignment:
| Q |
13 |
cataggtcaaatgtagcatgggttcctcgccagattttaatgaatgaagacctatttaaggttcatatcactgtgtcgtccatccagcatatagtcaaca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24620843 |
cataggtcaaatgtagcatgggttcctcgccagatttaaatgaatgaagacctatttaaggttcatatcattgtgtcgtccatccagcatatagtcaaca |
24620942 |
T |
|
| Q |
113 |
gaaacttgcgaaaaaattattgctgaaactgaaacta |
149 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
24620943 |
gaaatttgcgaaaaaattatggctgaaactgaaacta |
24620979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 13 - 188
Target Start/End: Complemental strand, 47570193 - 47570018
Alignment:
| Q |
13 |
cataggtcaaatgtagcatgggttcctcgccagattttaatgaatgaagacctatttaaggttcatatcactgtgtcgtccatccagcatatagtcaaca |
112 |
Q |
| |
|
|||||||||||||| | || | |||| ||||||||| |||| || |||||| ||| ||||||||||| | |||| |||||||||||| || ||||| | |
|
|
| T |
47570193 |
cataggtcaaatgttacttgtgctccttgccagatttcaatgcataaagacccattcaaggttcatattattgtgctgtccatccagcagatggtcaaaa |
47570094 |
T |
|
| Q |
113 |
gaaacttgcgaaaaaat-tattgctgaaactgaaactattatcttaaagatattgagaaaattcaaaacatctcatc |
188 |
Q |
| |
|
|||| || |||||||| ||| | ||||| |||||| ||||| |||||| ||||||||||||| ||||||||||| |
|
|
| T |
47570093 |
gaaatgtg-gaaaaaatatatggatgaaatggaaactgttatcctaaagaaattgagaaaattctgaacatctcatc |
47570018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University