View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_low_104 (Length: 221)
Name: NF9873_low_104
Description: NF9873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_low_104 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 44041638 - 44041436
Alignment:
| Q |
1 |
agcaattttcttcatacgatgggccagaatccagatgacatctttctgcagcctacaagcccaaaacggcccagtcttaggcaacggtttatacgacgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44041638 |
agcaattttcttcatacgatgggccagaatccagatgacatctttctgcagcctacaagcccaaaacggcccagtcttaggcaacggtttatacgacgtc |
44041539 |
T |
|
| Q |
101 |
gtattaaattgaacagttgatttggtttctgcgattgttgcgaaggaatgaggctatctctcgctgggtttcgaagttctttgcccttttctgggctaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44041538 |
gtattaaattgaacagttgatttggtttctgcgattgttgcgaaggaatgaggctatctctcgctgggtttcgaagttctttgcccttttctgggctaat |
44041439 |
T |
|
| Q |
201 |
cag |
203 |
Q |
| |
|
||| |
|
|
| T |
44041438 |
cag |
44041436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University