View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9873_low_104 (Length: 221)

Name: NF9873_low_104
Description: NF9873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9873_low_104
NF9873_low_104
[»] chr7 (1 HSPs)
chr7 (1-203)||(44041436-44041638)


Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 44041638 - 44041436
Alignment:
1 agcaattttcttcatacgatgggccagaatccagatgacatctttctgcagcctacaagcccaaaacggcccagtcttaggcaacggtttatacgacgtc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44041638 agcaattttcttcatacgatgggccagaatccagatgacatctttctgcagcctacaagcccaaaacggcccagtcttaggcaacggtttatacgacgtc 44041539  T
101 gtattaaattgaacagttgatttggtttctgcgattgttgcgaaggaatgaggctatctctcgctgggtttcgaagttctttgcccttttctgggctaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44041538 gtattaaattgaacagttgatttggtttctgcgattgttgcgaaggaatgaggctatctctcgctgggtttcgaagttctttgcccttttctgggctaat 44041439  T
201 cag 203  Q
    |||    
44041438 cag 44041436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University