View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_low_108 (Length: 213)
Name: NF9873_low_108
Description: NF9873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_low_108 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 16 - 138
Target Start/End: Complemental strand, 47352264 - 47352144
Alignment:
| Q |
16 |
acctgtgcaccagataaagataaaagatcagacaagttatctctaaagtaataagaaaaatgacgagagagggatgggggtggggaggagctaacttggt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47352264 |
acctgtgcaccagataaagataaaagatcagacaagttatctctaaagtaataagaaaagtgacgagagacggatgggggtggggaggagctaacttggt |
47352165 |
T |
 |
| Q |
116 |
attgactctagagcatttttaca |
138 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
47352164 |
attga--ctagagcatttttaca |
47352144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 47352084 - 47352016
Alignment:
| Q |
145 |
attgcattattttctaggattttgatactcagaaaggaaataacacagggaagaacaacaacacataac |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47352084 |
attgcattattttctaggattttgatactcagaaaggaaataacacagggaagaacaacaacacataac |
47352016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University