View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_low_11 (Length: 499)
Name: NF9873_low_11
Description: NF9873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_low_11 |
 | |
|
| [»] scaffold0002 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0002 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 8 - 245
Target Start/End: Original strand, 342763 - 343000
Alignment:
| Q |
8 |
ttggtggtgcagggggactcttgtgaataacggttggtgctggagctggtgcttgatgtctcctgtgcttgtgtctatgtcttcttctcttgtgcttgga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
342763 |
ttggtggtgcagggggactcttgtgaataacggttggtgctggagctggtgcttgatgtctcctgtgcttgtgtctatgtcttcttctcttgtgcttgga |
342862 |
T |
|
| Q |
108 |
ggactcaggtgctggtacaggtgcttctattgcaggcgttggtgcgggtattggtggtgaagtagcaggtgcaggagttggcgcttgctttgcgggtgca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
342863 |
ggactcaggtgctggtacaggtgcttctattgcaggcgttggtgcgggtattggtggtgaggtagcaggtgcaggagttggcgcttgctttgcgggtgca |
342962 |
T |
|
| Q |
208 |
ggtgctggcaccggtgttgcctttactggtgcaggggc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
342963 |
ggtgctggcaccggtgttgcctttactggtgcaggggc |
343000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 146; E-Value: 1e-76
Query Start/End: Original strand, 318 - 479
Target Start/End: Original strand, 343058 - 343219
Alignment:
| Q |
318 |
caatgttggagttgagacaggtgaactttttggtggttgaggtggtgggacttttgggcttgaagctggtgcaatttttggagctggtgatgtaactgga |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
343058 |
caatgttggagttgagacaggtgaactttttggtggttgaggtggtgggacttttgggcttgaagctggtgcaatttttggagctggtgatgtaactgga |
343157 |
T |
|
| Q |
418 |
gcagatttaggtgccacagttacaggcggttggcttgtgatgggaggagatgccaccacggt |
479 |
Q |
| |
|
|||||||| |||||||| || ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
343158 |
gcagatttgggtgccacggtaacaggtggttggcttgtgatgggaggagatgccaccacggt |
343219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University