View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_low_110 (Length: 201)
Name: NF9873_low_110
Description: NF9873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_low_110 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 10 - 183
Target Start/End: Complemental strand, 11368368 - 11368195
Alignment:
| Q |
10 |
taaccaagaaaaatactccacacagcataaaaatagctcctgagtatcttttggaagaaaaagaaaaggaccatagagaataggctctgcaagataaaag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11368368 |
taaccaagaaaaatactccacacagcataaaaatagctcctgagtatcttttggaagaaaaagaaaaggaccatagagaataggctctgcaagataaaag |
11368269 |
T |
 |
| Q |
110 |
ttgaaagaattagaggccaagtagcatattatcaacttatcaatgttaaagcatgctcaggtttatgtttacct |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11368268 |
ttgaaagaattagaggccaagtagcatattatcaacttatcaatgttaaagcatgctcaggtttatgtttacct |
11368195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University